AGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCT
Conversational genomics for everyone
Conversational bioinformatics for everyone
Attma is a new way to do self-serve genomic analytics. Anyone can ask questions in plain language and get detailed, trustworthy answers.
92% AI accuracy
HIPAA compliant
60-second insights
AI-Powered Platform
Transform how you analyze genomic data
Experience the power of conversational AI built specifically for clinical genomics and bioinformatics workflows
Natural Language Queries
Simply ask "Show me pathogenic BRCA1 variants" and get instant, accurate results. No complex syntax required.
92% AI Accuracy
AttmaAI delivers clinical variant interpretation with industry-leading 92% accuracy, surpassing competitors at 85-88%.
60-Second Insights
From VCF upload to comprehensive clinical report in 60 seconds. GPU-accelerated analysis for real-time results.
Team Collaboration
Real-time multi-user discussions, shared analyses, and collaborative case reviews with your clinical team.
ACMG Classification
Automated 5-tier clinical interpretation following ACMG/AMP guidelines with comprehensive evidence scoring.
Template Library
Pre-built genomics analyses for BRCA, Lynch syndrome, and more. Load templates and get insights instantly.
Core Capabilities
A modern approach toconversational genomics
Experience the power of AI-driven insights that understand your questions and deliver clinical-grade results
Ask Anything
Ask Anything
Type a question in plain language and get detailed, trustworthy answers. Our AI assistant understands genomics terminology and delivers accurate insights backed by clinical evidence.
- Natural language variant queries
- Context-aware follow-up questions
- Real-time genomic analysis results
Deep Reasoning for Genomics
Deep Reasoning for Genomics
AttmaAI goes beyond surface-level analysis. Our AI can explore multiple lines of inquiry, fix its own errors, and provide comprehensive clinical interpretation with 92% accuracy.
- Multi-turn conversational analysis
- ACMG/AMP classification automation
- Evidence-based clinical recommendations
Template Library
Template Library
Get started in 60 seconds with our pre-built genomics templates. Load BRCA analysis, Lynch syndrome screening, or custom workflows and customize them for your specific needs.
- Pre-configured genomic analyses
- One-click template loading
- Customizable clinical workflows
AI-Powered Intelligence
Deep clinical insightsyou can trustAttmaAI combines cutting-edge machine learning with clinical genomics expertise to deliver accurate, actionable insights
92%
Accuracy
AttmaAI Assistant
92% accuracy clinical variant interpretation. Our AI understands genomics terminology and delivers evidence-based insights.
∞
Follow-ups
Multi-turn Conversations
Context-aware discussions that remember previous queries. Ask follow-up questions and refine your analysis naturally.
5-Tier
Classification
ACMG Classification
Automated 5-tier clinical interpretation following ACMG/AMP guidelines with comprehensive evidence scoring.
Auto
Detection
Pedigree Analysis
Automatic inheritance pattern detection and family risk assessment with interactive pedigree visualization.
60s
Generation
Clinical Reports
AI-powered comprehensive patient reports generated in seconds. Export-ready with clinical recommendations.
Real-time
Sync
Team Collaboration
Real-time multi-user analysis sessions. Share insights, discuss cases, and collaborate with your clinical team.
Flexible Pricing
Start with AI-poweredclinical genomics
Choose the perfect plan with full AttmaAI access and conversational analysis capabilities
Starter
$499/month
Perfect for small research teams getting started
- Up to 5 users
- Basic AttmaAI access
- Natural language queries
- 100GB storage
- Email support
Most Popular
Professional
$999/month
Ideal for growing clinical genomics teams
- Up to 20 users
- Full AttmaAI with 92% accuracy
- Unlimited conversations
- Template library access
- ACMG classification automation
- 1TB storage
- Priority support
Enterprise
Custom Pricing
For large healthcare organizations
- Unlimited users
- Advanced AttmaAI features
- Custom AI model training
- Team collaboration tools
- Custom storage limits
- 24/7 dedicated support
- SLA guarantees
- On-premise deployment option
Have questions about pricing? View our FAQ or contact us